My DNA Molecule

ATTGTACCATAGTCAAGAGTAAAAATTGTCTGAAGCAATCGCCG

Historical influences on Darwin

1. Select one of the five individuals listed above who you would argue had the most influence over

Darwin’s development of his theory of Natural selection. This could be a positive or a negative influence.

Out of the five individuals listed above, I believe Alfred Russel Wallace had the most influence over the development of Darwin’s theory of natural selection. I believe this because little did both Darwin and Wallace know, they were basically working side by side. Also Wallace would help out Darwin with his studies, and when Wallace gave Darwin his theory of evolution, Darwin’s and Wallace’s they were similar.

2. Briefly (but completely) describe the contribution this individual made to the scientific community.

You must provide one link to an online source of information besides your textbook. No Wikipedia sources! (10 pts.)

One Alfred Russel Wallace’s biggest contributions to the scientific community is he is the co-founder of the natural selection theory. Wallace helped Darwin with his studies, and he also came up with a natural selection theory of his own, which was similar to Darwin’s theory. Wallace wanted Darwin’s help with publishing his theory and that is when Darwin came to realize their theories were very similar. Both Wallace and Darwin both went on to presenting their natural selection theory. Another contribution to the scientific community was the antivaccination movement. He and other scientists would vaccinate individuals for the small pox, however many people argued against it. However the research was very ambiguous and it was more of a he said she said at the time.

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3321934/

http://evolution.berkeley.edu/evolibrary/article/history_14

3. from the bullet point list above (under “How does evolution work?”), identify the point (or points) most directly affected by this individual’s work and thoroughly explain how this point was influenced by your selected individual. Again, this could be a positive effect, meaning Darwin built upon the knowledge this information provided, or a negative effect, meaning that Darwin demonstrated that this individual’s idea(s) were incorrect and the mechanism of natural selection was an alternative explanation. (10 pts.)

The point “if the environment changes, the traits that are helpful or adaptive to that environment will be different” directly influenced Wallace because when he was exploring, he would observe plants and animals and he noticed how each one had a mechanism for survival. Wallace noticed how some birds beaks were a certain way so it made cracking nuts open easier, some animals could camouflage so predators couldn’t see them, even plants had different defense mechanisms to fight off insects. This was a positive for Darwin because he had already been working on the same theory and Wallace helped him believe natural selection was true.

4. Could Darwin have developed his theory of natural selection without the influence and ideas of this individual? Explain. (10pts)

I believe Darwin could have developed his theory of natural selection without Wallace’s influence only because Darwin was already working on the same theory at the same time. Although Wallace did help Darwin out by providing him with birds to study. Darwin had already been working on this theory and when Wallace showed him that he had thought of the same ideas, it could have strengthened his belief.

5. How did the attitude of the church affect Darwin and his eventual publication of his book On the Origin of Species? (10 pts.)

            I believe the church didn’t really affect the Darwin and the eventual publication of this book because even before Darwin wrote the book it was always a thought. Although it was frown upon by the church some Christians saw it as the plan of god. Some Christians did not see the book as a threat to their religion, however many of them did see it as atheistic.